ID: 1047830156

View in Genome Browser
Species Human (GRCh38)
Location 8:128620811-128620833
Sequence CCACAGATACAGAGGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047830156_1047830162 -8 Left 1047830156 8:128620811-128620833 CCATTGTCCCTCTGTATCTGTGG No data
Right 1047830162 8:128620826-128620848 ATCTGTGGGGAATTAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047830156 Original CRISPR CCACAGATACAGAGGGACAA TGG (reversed) Intergenic
No off target data available for this crispr