ID: 1047836360

View in Genome Browser
Species Human (GRCh38)
Location 8:128697770-128697792
Sequence TTGGGGCCTGACTGTTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047836360_1047836364 3 Left 1047836360 8:128697770-128697792 CCAATTAAACAGTCAGGCCCCAA No data
Right 1047836364 8:128697796-128697818 CTCTGCCATCACAAAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047836360 Original CRISPR TTGGGGCCTGACTGTTTAAT TGG (reversed) Intergenic
No off target data available for this crispr