ID: 1047844254

View in Genome Browser
Species Human (GRCh38)
Location 8:128788885-128788907
Sequence GGCTTTACAATGTGTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047844254_1047844260 9 Left 1047844254 8:128788885-128788907 CCAAGCTGACACATTGTAAAGCC No data
Right 1047844260 8:128788917-128788939 TATTTGTGATAACAGGGGTGTGG No data
1047844254_1047844259 4 Left 1047844254 8:128788885-128788907 CCAAGCTGACACATTGTAAAGCC No data
Right 1047844259 8:128788912-128788934 TGATGTATTTGTGATAACAGGGG No data
1047844254_1047844257 2 Left 1047844254 8:128788885-128788907 CCAAGCTGACACATTGTAAAGCC No data
Right 1047844257 8:128788910-128788932 CATGATGTATTTGTGATAACAGG No data
1047844254_1047844261 14 Left 1047844254 8:128788885-128788907 CCAAGCTGACACATTGTAAAGCC No data
Right 1047844261 8:128788922-128788944 GTGATAACAGGGGTGTGGTTTGG No data
1047844254_1047844258 3 Left 1047844254 8:128788885-128788907 CCAAGCTGACACATTGTAAAGCC No data
Right 1047844258 8:128788911-128788933 ATGATGTATTTGTGATAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047844254 Original CRISPR GGCTTTACAATGTGTCAGCT TGG (reversed) Intergenic
No off target data available for this crispr