ID: 1047846443

View in Genome Browser
Species Human (GRCh38)
Location 8:128810909-128810931
Sequence CACACTTAGCACTCAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047846442_1047846443 -9 Left 1047846442 8:128810895-128810917 CCAATAGCAATTAGCACACTTAG No data
Right 1047846443 8:128810909-128810931 CACACTTAGCACTCAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047846443 Original CRISPR CACACTTAGCACTCAGATCT TGG Intergenic
No off target data available for this crispr