ID: 1047847434

View in Genome Browser
Species Human (GRCh38)
Location 8:128823001-128823023
Sequence CTGGTTTACCTGGTCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047847434_1047847438 -7 Left 1047847434 8:128823001-128823023 CCACCTGAGACCAGGTAAACCAG No data
Right 1047847438 8:128823017-128823039 AAACCAGAATTTGTAGAGGTAGG No data
1047847434_1047847439 -6 Left 1047847434 8:128823001-128823023 CCACCTGAGACCAGGTAAACCAG No data
Right 1047847439 8:128823018-128823040 AACCAGAATTTGTAGAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047847434 Original CRISPR CTGGTTTACCTGGTCTCAGG TGG (reversed) Intergenic
No off target data available for this crispr