ID: 1047847438

View in Genome Browser
Species Human (GRCh38)
Location 8:128823017-128823039
Sequence AAACCAGAATTTGTAGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047847435_1047847438 -10 Left 1047847435 8:128823004-128823026 CCTGAGACCAGGTAAACCAGAAT No data
Right 1047847438 8:128823017-128823039 AAACCAGAATTTGTAGAGGTAGG No data
1047847431_1047847438 1 Left 1047847431 8:128822993-128823015 CCTGAAACCCACCTGAGACCAGG No data
Right 1047847438 8:128823017-128823039 AAACCAGAATTTGTAGAGGTAGG No data
1047847433_1047847438 -6 Left 1047847433 8:128823000-128823022 CCCACCTGAGACCAGGTAAACCA No data
Right 1047847438 8:128823017-128823039 AAACCAGAATTTGTAGAGGTAGG No data
1047847434_1047847438 -7 Left 1047847434 8:128823001-128823023 CCACCTGAGACCAGGTAAACCAG No data
Right 1047847438 8:128823017-128823039 AAACCAGAATTTGTAGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047847438 Original CRISPR AAACCAGAATTTGTAGAGGT AGG Intergenic
No off target data available for this crispr