ID: 1047847439

View in Genome Browser
Species Human (GRCh38)
Location 8:128823018-128823040
Sequence AACCAGAATTTGTAGAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047847433_1047847439 -5 Left 1047847433 8:128823000-128823022 CCCACCTGAGACCAGGTAAACCA No data
Right 1047847439 8:128823018-128823040 AACCAGAATTTGTAGAGGTAGGG No data
1047847434_1047847439 -6 Left 1047847434 8:128823001-128823023 CCACCTGAGACCAGGTAAACCAG No data
Right 1047847439 8:128823018-128823040 AACCAGAATTTGTAGAGGTAGGG No data
1047847431_1047847439 2 Left 1047847431 8:128822993-128823015 CCTGAAACCCACCTGAGACCAGG No data
Right 1047847439 8:128823018-128823040 AACCAGAATTTGTAGAGGTAGGG No data
1047847435_1047847439 -9 Left 1047847435 8:128823004-128823026 CCTGAGACCAGGTAAACCAGAAT No data
Right 1047847439 8:128823018-128823040 AACCAGAATTTGTAGAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047847439 Original CRISPR AACCAGAATTTGTAGAGGTA GGG Intergenic
No off target data available for this crispr