ID: 1047853835

View in Genome Browser
Species Human (GRCh38)
Location 8:128888397-128888419
Sequence CTGTAACTACAGTAGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047853833_1047853835 13 Left 1047853833 8:128888361-128888383 CCTAGCAAAATCTTTGCAAGATA No data
Right 1047853835 8:128888397-128888419 CTGTAACTACAGTAGGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047853835 Original CRISPR CTGTAACTACAGTAGGAATT AGG Intergenic
No off target data available for this crispr