ID: 1047855783

View in Genome Browser
Species Human (GRCh38)
Location 8:128910117-128910139
Sequence TCTCCTTGAAGGTGTCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047855783_1047855793 27 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855793 8:128910167-128910189 AAGGGTAACAGAGGGTAAAAGGG No data
1047855783_1047855788 9 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855788 8:128910149-128910171 ATGTTATGGAATTGCCAGAAGGG No data
1047855783_1047855792 26 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855792 8:128910166-128910188 GAAGGGTAACAGAGGGTAAAAGG No data
1047855783_1047855785 -5 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855785 8:128910135-128910157 GGAGACCAAGATAGATGTTATGG No data
1047855783_1047855787 8 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855787 8:128910148-128910170 GATGTTATGGAATTGCCAGAAGG No data
1047855783_1047855789 18 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855789 8:128910158-128910180 AATTGCCAGAAGGGTAACAGAGG No data
1047855783_1047855790 19 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855790 8:128910159-128910181 ATTGCCAGAAGGGTAACAGAGGG No data
1047855783_1047855794 28 Left 1047855783 8:128910117-128910139 CCTGTAGGACACCTTCAAGGAGA No data
Right 1047855794 8:128910168-128910190 AGGGTAACAGAGGGTAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047855783 Original CRISPR TCTCCTTGAAGGTGTCCTAC AGG (reversed) Intergenic
No off target data available for this crispr