ID: 1047859191

View in Genome Browser
Species Human (GRCh38)
Location 8:128946037-128946059
Sequence GTGAAGAAAGTGATGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047859186_1047859191 15 Left 1047859186 8:128945999-128946021 CCCAACCTGGAAATGCAGATATT No data
Right 1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG No data
1047859187_1047859191 14 Left 1047859187 8:128946000-128946022 CCAACCTGGAAATGCAGATATTA No data
Right 1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG No data
1047859188_1047859191 10 Left 1047859188 8:128946004-128946026 CCTGGAAATGCAGATATTATCCT No data
Right 1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG No data
1047859189_1047859191 -10 Left 1047859189 8:128946024-128946046 CCTCATTCTAAAAGTGAAGAAAG No data
Right 1047859191 8:128946037-128946059 GTGAAGAAAGTGATGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047859191 Original CRISPR GTGAAGAAAGTGATGGTCAG AGG Intergenic
No off target data available for this crispr