ID: 1047859191 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:128946037-128946059 |
Sequence | GTGAAGAAAGTGATGGTCAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1047859186_1047859191 | 15 | Left | 1047859186 | 8:128945999-128946021 | CCCAACCTGGAAATGCAGATATT | No data | ||
Right | 1047859191 | 8:128946037-128946059 | GTGAAGAAAGTGATGGTCAGAGG | No data | ||||
1047859187_1047859191 | 14 | Left | 1047859187 | 8:128946000-128946022 | CCAACCTGGAAATGCAGATATTA | No data | ||
Right | 1047859191 | 8:128946037-128946059 | GTGAAGAAAGTGATGGTCAGAGG | No data | ||||
1047859188_1047859191 | 10 | Left | 1047859188 | 8:128946004-128946026 | CCTGGAAATGCAGATATTATCCT | No data | ||
Right | 1047859191 | 8:128946037-128946059 | GTGAAGAAAGTGATGGTCAGAGG | No data | ||||
1047859189_1047859191 | -10 | Left | 1047859189 | 8:128946024-128946046 | CCTCATTCTAAAAGTGAAGAAAG | No data | ||
Right | 1047859191 | 8:128946037-128946059 | GTGAAGAAAGTGATGGTCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1047859191 | Original CRISPR | GTGAAGAAAGTGATGGTCAG AGG | Intergenic | ||
No off target data available for this crispr |