ID: 1047859274

View in Genome Browser
Species Human (GRCh38)
Location 8:128946828-128946850
Sequence ACAAATGTATTGTTCTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047859274_1047859276 -10 Left 1047859274 8:128946828-128946850 CCCTGCAAGAACAATACATTTGT No data
Right 1047859276 8:128946841-128946863 ATACATTTGTTTCCTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047859274 Original CRISPR ACAAATGTATTGTTCTTGCA GGG (reversed) Intergenic
No off target data available for this crispr