ID: 1047860023

View in Genome Browser
Species Human (GRCh38)
Location 8:128955651-128955673
Sequence ATCCTTGTCATTGCTAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047860019_1047860023 18 Left 1047860019 8:128955610-128955632 CCTGGTAGATGTTTATCTCGCAG 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1047860023 8:128955651-128955673 ATCCTTGTCATTGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047860023 Original CRISPR ATCCTTGTCATTGCTAGAGG AGG Intergenic
900426235 1:2580689-2580711 ATCCTGGGCTTTGCTGGAGGGGG + Intergenic
906405566 1:45539332-45539354 ATCCTTCTCCTTCCTGGAGGGGG + Intergenic
907798652 1:57742630-57742652 GTCCTTGTCTGTGCTAGGGGAGG - Intronic
908495997 1:64695532-64695554 ATGCTTGTCATTGCTTGGGGTGG + Intergenic
912651282 1:111441808-111441830 AGCCGTGTCCTTGGTAGAGGGGG - Intronic
914004455 1:143720367-143720389 ATCCTTATCCGTGCTAGGGGCGG + Intergenic
916270940 1:162940727-162940749 ATCCTTTCCTTTGATAGAGGAGG + Intergenic
917205510 1:172566737-172566759 ATCCTTGTCATGGAAAGGGGTGG + Intronic
921524310 1:216198419-216198441 ATGGTTGTCATTGTTTGAGGAGG + Exonic
922183612 1:223255640-223255662 AACCTTGTATTAGCTAGAGGAGG + Intronic
1062818775 10:518845-518867 ATCCTAGTAACTGCTGGAGGTGG - Intronic
1063266077 10:4452390-4452412 TTCCATGTCATTGGTCGAGGAGG + Intergenic
1063910755 10:10827589-10827611 ATACTTTCCATGGCTAGAGGAGG - Intergenic
1064466820 10:15591711-15591733 CTGCTTATCATTGCTAGAGAAGG + Intronic
1068167528 10:53350705-53350727 AACCTTGTCCTTGCAGGAGGAGG - Intergenic
1074935895 10:118181265-118181287 ATCATTGTCATTACTACAGTGGG + Intergenic
1075754279 10:124798714-124798736 ATCCCTGTCTTTGCTAGGTGTGG + Intergenic
1076580090 10:131501714-131501736 AACCTTGTCATTGGTAAAAGTGG - Intergenic
1078754378 11:14194933-14194955 ATTCTTGAAAATGCTAGAGGGGG + Intronic
1079328275 11:19512727-19512749 CTCCTTGTCAGTGCTGGAGAGGG + Intronic
1082646564 11:55733920-55733942 AGCCTTGTTGTTGATAGAGGAGG - Intergenic
1087348671 11:97003644-97003666 ATCCTTATAAGTGATAGAGGTGG + Intergenic
1092760142 12:11802545-11802567 ATCCTTGTCATTGTCAGACATGG + Intronic
1092852766 12:12646100-12646122 TTCCTAGTCATTTCTAGAGTTGG - Intergenic
1100119915 12:91357757-91357779 ATCCTAATAATTGCTAGGGGAGG + Intergenic
1102091707 12:110195488-110195510 ATTTTTTTAATTGCTAGAGGTGG - Intronic
1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG + Intronic
1105948466 13:25209383-25209405 ATCCTTGTCACTGCCTGAGATGG - Intergenic
1106124864 13:26892443-26892465 AACCTAGTCATTGCCTGAGGAGG + Intergenic
1107056986 13:36116612-36116634 ATCCTTCACATTACTAGAGCTGG + Intronic
1112416193 13:99205351-99205373 ATGCTTCTCATTGCTGTAGGAGG + Intronic
1113050956 13:106211438-106211460 ATTCTTTTCTTTGCTAGAGTGGG - Intergenic
1118633744 14:67728841-67728863 ATCTTTATCATTTCTAAAGGAGG - Intronic
1130672160 15:85922245-85922267 ATCCTTGTCCTTGATGGAAGAGG + Intergenic
1131830732 15:96353039-96353061 ATCCATGTCAGCACTAGAGGAGG + Intergenic
1135835920 16:25825028-25825050 ATCGTTGTCATTACAAGAAGAGG + Intronic
1139240540 16:65387561-65387583 TTCCTTTTCTTTGCTAGAGATGG + Intergenic
1139509635 16:67419682-67419704 TTCCTTCTCTTTGTTAGAGGAGG + Intergenic
1145964552 17:28907445-28907467 CTCCCTGTCATTCCTGGAGGAGG - Intronic
1150019073 17:61592458-61592480 ATCCTTTTCATTGTAATAGGAGG + Intergenic
1155206349 18:23561475-23561497 GGCCTTGTCATTACTTGAGGGGG + Exonic
1157610842 18:48954097-48954119 ATCTTTTTAATTGCTAGAGGGGG - Intergenic
1160436491 18:78856238-78856260 ATCAGTGTCATTGCAACAGGGGG + Intergenic
1163712593 19:18855542-18855564 AGCCTTGGCATTGCTTGCGGTGG + Intronic
1168110137 19:54187646-54187668 ATCCATGTCATGGAGAGAGGTGG - Intronic
925626510 2:5846733-5846755 TTCCTTCTCATTGCTAGAGATGG - Intergenic
926165047 2:10517016-10517038 TTCCTTGTTATTTCTAAAGGGGG + Intergenic
930511647 2:52352773-52352795 AATGTTGTCATTGCTAGAGTGGG + Intergenic
931215909 2:60244459-60244481 TTCCATGTCATTACTAGAGTGGG - Intergenic
933034964 2:77384875-77384897 AAATTTGTCTTTGCTAGAGGTGG - Intronic
936440906 2:112552117-112552139 ATCCTGGTCCTTGCTAGCCGGGG + Intronic
1170732601 20:18987645-18987667 ATCCTTTTCTTTGGTGGAGGAGG - Intergenic
1170950553 20:20932143-20932165 TTCCTTGGCATTGCTAGAGATGG + Intergenic
1176662183 21:9647436-9647458 ATCCTTTTCTTCCCTAGAGGAGG - Intergenic
1178797758 21:35760884-35760906 ATTGTTGTCATTGATACAGGTGG - Intronic
1182061549 22:27402014-27402036 ATACTAGTGATTGCTGGAGGGGG + Intergenic
1182883112 22:33750714-33750736 AGCCGTGTCATTGCAAGAGCTGG + Intronic
950488855 3:13289983-13290005 TTCCTTGCCATTGCGAGAGTGGG + Intergenic
952123128 3:30268095-30268117 ATCCTTGCCATTACTTGAGGAGG - Intergenic
954842776 3:53526483-53526505 AACATTGTCCTTCCTAGAGGTGG + Intronic
955197478 3:56818452-56818474 ATACTAGTCATTTCAAGAGGAGG - Intronic
956955011 3:74327693-74327715 ATCCTTATTATTGGTGGAGGTGG + Intronic
958127488 3:89375910-89375932 AACATTCTCATTGCTAGAGTTGG - Intronic
958528046 3:95287962-95287984 TTCTTGGTCATTGCTGGAGGAGG - Intergenic
960250851 3:115451043-115451065 AGCATTGTCATTGCTATAGATGG + Intergenic
960545544 3:118910486-118910508 GTCCTTGTCATTTCTTGATGGGG + Intronic
962623397 3:137201070-137201092 ATCTTTGTTATTGGTAGAGACGG + Intergenic
962896049 3:139715846-139715868 ATCCATGTCAGGGCTTGAGGAGG - Intergenic
964738660 3:159942991-159943013 ATCCTGGTAATTGCAAGAGGAGG - Intergenic
965219632 3:165911986-165912008 ATCATTGAAATTACTAGAGGAGG + Intergenic
972808106 4:42551755-42551777 AACCTTTTTATTGCTAGAGTAGG + Intronic
972860297 4:43160390-43160412 ATCCTTGTTCTTGCTGGAGGAGG - Intergenic
976201516 4:82584142-82584164 ATCCCTGTCATTCCTACAGATGG + Intergenic
977772216 4:100873016-100873038 TTCCTTGTGATTCCTAGAGAAGG - Intronic
981166878 4:141570201-141570223 ATCTTTATCATTGCTAGAGATGG + Intergenic
985413211 4:189709080-189709102 ATCCTTTTCTTCCCTAGAGGAGG + Intergenic
989046254 5:37276736-37276758 ATCCTTGCCAATGCTAGAAATGG + Intergenic
990601359 5:57361657-57361679 ATCCTTGTCTTTGCCACATGAGG - Intergenic
993135689 5:83959046-83959068 ATTCTTGTGAATGCTATAGGAGG + Intronic
996152197 5:120052964-120052986 TTCCTTGTCATTTCTAAAGAGGG - Intergenic
997869640 5:137496564-137496586 TTGCTTGACTTTGCTAGAGGTGG - Intronic
1006195051 6:32235071-32235093 CTCCTTGTTATTGCTAGGTGTGG + Intergenic
1007211877 6:40198843-40198865 ATCCTTATGCTTGCTAGAGGTGG - Intergenic
1009662996 6:66637652-66637674 ATCCTTTTTATTTCTAGAGACGG + Intergenic
1011351853 6:86432560-86432582 ATCCTGGGCCTTGCTGGAGGAGG + Intergenic
1012693939 6:102354005-102354027 ATCCTTTTCCTTGTCAGAGGAGG - Intergenic
1015137840 6:129893695-129893717 ATCCTTGACAATGATAGATGAGG - Intergenic
1019589407 7:1823164-1823186 AGCCTTGTCTTTGCTACAGCTGG + Intronic
1020255633 7:6501796-6501818 AAACTTGTCCTCGCTAGAGGGGG + Exonic
1020581395 7:10007248-10007270 ATTCTTGTCATTGTGATAGGTGG - Intergenic
1022770411 7:33465872-33465894 ATCCTTTTTATTGCTAGAAAGGG - Intronic
1023222746 7:37936530-37936552 ATCCATATCATTGATAGAGATGG - Intronic
1025978326 7:66387194-66387216 ATCCTTGTAATTGCTGGGCGTGG + Intronic
1029266324 7:99344120-99344142 ATCCTTGCCTTTCCTTGAGGCGG + Intronic
1034330782 7:150280313-150280335 ACCCCTGTCATTCCTGGAGGCGG + Intronic
1034404424 7:150892577-150892599 ATCCTTGTCACTATAAGAGGTGG - Intergenic
1034667262 7:152829536-152829558 ACCCCTGTCATTTCTGGAGGCGG - Intronic
1038182221 8:25240043-25240065 GTCCTTGACATTGCCAGTGGTGG - Intronic
1041014158 8:53573965-53573987 ATCCTTGCCATTGCTGGGTGGGG - Intergenic
1046160339 8:110354762-110354784 ATTCTTTACATTTCTAGAGGAGG + Intergenic
1047860023 8:128955651-128955673 ATCCTTGTCATTGCTAGAGGAGG + Intergenic
1054713828 9:68537797-68537819 ATCCTTGTCAACATTAGAGGAGG + Intronic
1055199905 9:73647021-73647043 TTGCTTGACATTGCTAGTGGGGG + Intergenic
1058553657 9:106142576-106142598 ATCCGTGAAAATGCTAGAGGAGG + Intergenic
1058990827 9:110254671-110254693 ACCTTTGTCACTGGTAGAGGAGG + Intronic
1186761355 X:12726008-12726030 AGTCTTTGCATTGCTAGAGGGGG - Intergenic
1187525745 X:20053143-20053165 AGCCTGGTCATTTCTAGAGTAGG - Intronic
1187678110 X:21738503-21738525 TTCCTTCTATTTGCTAGAGGTGG + Intronic
1188383889 X:29532225-29532247 ATCCTTGTCAGAGAGAGAGGAGG - Intronic
1189063973 X:37786433-37786455 ATCCTTGTCATTTCTAGTCTAGG - Intronic
1189138600 X:38577277-38577299 ATATTTTTCATTGATAGAGGTGG + Intronic
1189583526 X:42432918-42432940 CACCTTGTCATTGGCAGAGGAGG - Intergenic
1192607888 X:72538737-72538759 AAGCTAGTCCTTGCTAGAGGAGG - Intronic
1194624353 X:96211442-96211464 ATCCTTATCATTTGTAAAGGAGG - Intergenic
1199237883 X:145511374-145511396 CAGCTTGTCATGGCTAGAGGAGG - Intergenic