ID: 1047863400

View in Genome Browser
Species Human (GRCh38)
Location 8:128993925-128993947
Sequence CCTGATCTTTGGAAGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047863395_1047863400 1 Left 1047863395 8:128993901-128993923 CCTTTCTACATTTGAAAACAGTC No data
Right 1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG No data
1047863394_1047863400 22 Left 1047863394 8:128993880-128993902 CCTGTGATTTATGGGCTGGCTCC No data
Right 1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG No data
1047863393_1047863400 23 Left 1047863393 8:128993879-128993901 CCCTGTGATTTATGGGCTGGCTC No data
Right 1047863400 8:128993925-128993947 CCTGATCTTTGGAAGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047863400 Original CRISPR CCTGATCTTTGGAAGGCGGA AGG Intergenic
No off target data available for this crispr