ID: 1047866840

View in Genome Browser
Species Human (GRCh38)
Location 8:129033956-129033978
Sequence CATCTTCTGCACAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047866834_1047866840 30 Left 1047866834 8:129033903-129033925 CCACTCACTGCCTTGTCACGACA No data
Right 1047866840 8:129033956-129033978 CATCTTCTGCACAAATTGGAAGG No data
1047866837_1047866840 2 Left 1047866837 8:129033931-129033953 CCACAGCACCAAAGAGGTATCTC No data
Right 1047866840 8:129033956-129033978 CATCTTCTGCACAAATTGGAAGG No data
1047866838_1047866840 -6 Left 1047866838 8:129033939-129033961 CCAAAGAGGTATCTCGTCATCTT No data
Right 1047866840 8:129033956-129033978 CATCTTCTGCACAAATTGGAAGG No data
1047866835_1047866840 20 Left 1047866835 8:129033913-129033935 CCTTGTCACGACAGAGAGCCACA No data
Right 1047866840 8:129033956-129033978 CATCTTCTGCACAAATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047866840 Original CRISPR CATCTTCTGCACAAATTGGA AGG Intergenic
No off target data available for this crispr