ID: 1047867025

View in Genome Browser
Species Human (GRCh38)
Location 8:129035966-129035988
Sequence GGGAGAAATAGGAGGACTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047867016_1047867025 24 Left 1047867016 8:129035919-129035941 CCCGGGTAATTGACAGTCTTCAC No data
Right 1047867025 8:129035966-129035988 GGGAGAAATAGGAGGACTAATGG No data
1047867020_1047867025 2 Left 1047867020 8:129035941-129035963 CCATTTACATGGCATATATTGGT No data
Right 1047867025 8:129035966-129035988 GGGAGAAATAGGAGGACTAATGG No data
1047867017_1047867025 23 Left 1047867017 8:129035920-129035942 CCGGGTAATTGACAGTCTTCACC No data
Right 1047867025 8:129035966-129035988 GGGAGAAATAGGAGGACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047867025 Original CRISPR GGGAGAAATAGGAGGACTAA TGG Intergenic
No off target data available for this crispr