ID: 1047868184

View in Genome Browser
Species Human (GRCh38)
Location 8:129052411-129052433
Sequence CTGCTTCACAATGAATAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047868184_1047868188 25 Left 1047868184 8:129052411-129052433 CCTACCTATTCATTGTGAAGCAG No data
Right 1047868188 8:129052459-129052481 CATCTCAATCTCTTTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047868184 Original CRISPR CTGCTTCACAATGAATAGGT AGG (reversed) Intergenic
No off target data available for this crispr