ID: 1047869431

View in Genome Browser
Species Human (GRCh38)
Location 8:129066323-129066345
Sequence TCCTTCTTGAGTTTGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047869431_1047869436 17 Left 1047869431 8:129066323-129066345 CCCAGACACAAACTCAAGAAGGA No data
Right 1047869436 8:129066363-129066385 CTATATAAAACGGCAATAAAAGG No data
1047869431_1047869433 7 Left 1047869431 8:129066323-129066345 CCCAGACACAAACTCAAGAAGGA No data
Right 1047869433 8:129066353-129066375 ATATTTCCTCCTATATAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047869431 Original CRISPR TCCTTCTTGAGTTTGTGTCT GGG (reversed) Intergenic
No off target data available for this crispr