ID: 1047869432

View in Genome Browser
Species Human (GRCh38)
Location 8:129066324-129066346
Sequence CTCCTTCTTGAGTTTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047869432_1047869436 16 Left 1047869432 8:129066324-129066346 CCAGACACAAACTCAAGAAGGAG No data
Right 1047869436 8:129066363-129066385 CTATATAAAACGGCAATAAAAGG No data
1047869432_1047869433 6 Left 1047869432 8:129066324-129066346 CCAGACACAAACTCAAGAAGGAG No data
Right 1047869433 8:129066353-129066375 ATATTTCCTCCTATATAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047869432 Original CRISPR CTCCTTCTTGAGTTTGTGTC TGG (reversed) Intergenic
No off target data available for this crispr