ID: 1047869436

View in Genome Browser
Species Human (GRCh38)
Location 8:129066363-129066385
Sequence CTATATAAAACGGCAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047869432_1047869436 16 Left 1047869432 8:129066324-129066346 CCAGACACAAACTCAAGAAGGAG No data
Right 1047869436 8:129066363-129066385 CTATATAAAACGGCAATAAAAGG No data
1047869431_1047869436 17 Left 1047869431 8:129066323-129066345 CCCAGACACAAACTCAAGAAGGA No data
Right 1047869436 8:129066363-129066385 CTATATAAAACGGCAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047869436 Original CRISPR CTATATAAAACGGCAATAAA AGG Intergenic
No off target data available for this crispr