ID: 1047874160 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:129116709-129116731 |
Sequence | CTGGGTCTCTAAATGGAAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1047874150_1047874160 | 25 | Left | 1047874150 | 8:129116661-129116683 | CCTGTTCTCTGGCCTTCAGACTC | No data | ||
Right | 1047874160 | 8:129116709-129116731 | CTGGGTCTCTAAATGGAAGATGG | No data | ||||
1047874153_1047874160 | 13 | Left | 1047874153 | 8:129116673-129116695 | CCTTCAGACTCGGGCTGAACTAT | No data | ||
Right | 1047874160 | 8:129116709-129116731 | CTGGGTCTCTAAATGGAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1047874160 | Original CRISPR | CTGGGTCTCTAAATGGAAGA TGG | Intergenic | ||
No off target data available for this crispr |