ID: 1047874160

View in Genome Browser
Species Human (GRCh38)
Location 8:129116709-129116731
Sequence CTGGGTCTCTAAATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047874150_1047874160 25 Left 1047874150 8:129116661-129116683 CCTGTTCTCTGGCCTTCAGACTC No data
Right 1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG No data
1047874153_1047874160 13 Left 1047874153 8:129116673-129116695 CCTTCAGACTCGGGCTGAACTAT No data
Right 1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047874160 Original CRISPR CTGGGTCTCTAAATGGAAGA TGG Intergenic
No off target data available for this crispr