ID: 1047874661

View in Genome Browser
Species Human (GRCh38)
Location 8:129122785-129122807
Sequence CTGAGCTCACAGCTGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047874659_1047874661 2 Left 1047874659 8:129122760-129122782 CCTCTATGTTTTACTTCTGTGGT No data
Right 1047874661 8:129122785-129122807 CTGAGCTCACAGCTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047874661 Original CRISPR CTGAGCTCACAGCTGGAGTG AGG Intergenic
No off target data available for this crispr