ID: 1047885050

View in Genome Browser
Species Human (GRCh38)
Location 8:129240922-129240944
Sequence GTCTCATAGAGCTTATACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047885050_1047885053 26 Left 1047885050 8:129240922-129240944 CCCAAGTATAAGCTCTATGAGAC No data
Right 1047885053 8:129240971-129240993 CATTTTCTTTCCTTAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047885050 Original CRISPR GTCTCATAGAGCTTATACTT GGG (reversed) Intergenic
No off target data available for this crispr