ID: 1047885053

View in Genome Browser
Species Human (GRCh38)
Location 8:129240971-129240993
Sequence CATTTTCTTTCCTTAGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047885052_1047885053 4 Left 1047885052 8:129240944-129240966 CCTATAATCAGTTTCTCTCTAAT No data
Right 1047885053 8:129240971-129240993 CATTTTCTTTCCTTAGATTTTGG No data
1047885051_1047885053 25 Left 1047885051 8:129240923-129240945 CCAAGTATAAGCTCTATGAGACC No data
Right 1047885053 8:129240971-129240993 CATTTTCTTTCCTTAGATTTTGG No data
1047885050_1047885053 26 Left 1047885050 8:129240922-129240944 CCCAAGTATAAGCTCTATGAGAC No data
Right 1047885053 8:129240971-129240993 CATTTTCTTTCCTTAGATTTTGG No data
1047885049_1047885053 27 Left 1047885049 8:129240921-129240943 CCCCAAGTATAAGCTCTATGAGA No data
Right 1047885053 8:129240971-129240993 CATTTTCTTTCCTTAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047885053 Original CRISPR CATTTTCTTTCCTTAGATTT TGG Intergenic
No off target data available for this crispr