ID: 1047885077

View in Genome Browser
Species Human (GRCh38)
Location 8:129241244-129241266
Sequence CATCAGAGGCACATTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047885072_1047885077 6 Left 1047885072 8:129241215-129241237 CCGGCAAGAGGGAGCCTCAGCCA 0: 1
1: 0
2: 3
3: 17
4: 207
Right 1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG 0: 1
1: 0
2: 2
3: 15
4: 288
1047885073_1047885077 -8 Left 1047885073 8:129241229-129241251 CCTCAGCCAACACTACATCAGAG 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG 0: 1
1: 0
2: 2
3: 15
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047885077 Original CRISPR CATCAGAGGCACATTGTGGA TGG Intergenic
900152571 1:1185046-1185068 CATCAGTGACACGTTCTGGAAGG + Exonic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
903974057 1:27137836-27137858 AGTCAGGGGCACATTGGGGAGGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907673475 1:56497390-56497412 CATCATAAGCACATTGAGGCAGG - Intronic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908392748 1:63698492-63698514 CACCAGCCGCACATTGTTGATGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908867399 1:68565686-68565708 CATCAGGGGCACATTATGAAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910289498 1:85586883-85586905 CAACAGAGGCACATTGCAGAAGG - Intergenic
912513004 1:110201234-110201256 CATCAAAAGCACAGTGGGGAGGG - Exonic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914454769 1:147825387-147825409 CATCACAGGAACATTGAGCAGGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917561769 1:176165803-176165825 GATCAGAGCCAGATTGTGAAGGG + Intronic
918808789 1:189087585-189087607 CATGAGAGGGACCTTGTGGGAGG + Intergenic
919042302 1:192405803-192405825 CTTAAGAGCCACACTGTGGAAGG + Intergenic
920566547 1:206978543-206978565 CAGCACAGCCACATGGTGGAAGG - Intergenic
920728428 1:208459892-208459914 CATGAGATGCATATGGTGGAAGG - Intergenic
921668005 1:217895506-217895528 GATTAGAGGCAGATTTTGGAAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922889436 1:229048933-229048955 CATCAGATTCATATTGTGGGAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064267712 10:13838388-13838410 CATAAATGGCACATTGTGGCTGG - Intronic
1068873622 10:61973107-61973129 CCTCAGAGGCTCATTGTGGATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1071893921 10:90043325-90043347 CATAAGAGGGACCTGGTGGAAGG + Intergenic
1072100682 10:92226738-92226760 CATCAAAGGCATATTGAGGGAGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072749142 10:97964256-97964278 CATCAGAATCACATGGTGGGGGG + Intronic
1073636168 10:105200921-105200943 CATAAAAGGAACATTATGGAAGG - Intronic
1076899226 10:133328900-133328922 GATCAGAGGCACACTGTCCATGG + Exonic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078659598 11:13276771-13276793 CATCTCAGGCACTTTGTAGAGGG - Intronic
1080195381 11:29602341-29602363 CCTCAGAGTCTCATTGTGGAAGG - Intergenic
1080726566 11:34904179-34904201 CCTCAGAGGCTCTTTGTGGATGG - Intronic
1081698099 11:45132653-45132675 GCTCAGAGGCAGATTGTGAAAGG - Intronic
1081873970 11:46396487-46396509 CATCATAGAAACATTGTGGTGGG - Exonic
1084433720 11:69126032-69126054 CAGCAGAGGCACAGGCTGGAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086304974 11:85470055-85470077 TGTCAGAGGAACAGTGTGGATGG - Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088183664 11:107139968-107139990 CACCAGAGGCAAATTGAGGAGGG - Intergenic
1088378493 11:109167945-109167967 CCTGAGAGGCACACTTTGGAAGG + Intergenic
1088652902 11:111974147-111974169 CAGCAGTGGCACAGTGTGGTCGG - Exonic
1089943009 11:122439411-122439433 CTTGAGAGTCACACTGTGGAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091192840 11:133708717-133708739 AGTCAGAGGCACAAGGTGGAGGG - Intergenic
1091545558 12:1499343-1499365 CATCAGGGCCACACTGTGGCTGG + Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094711020 12:32962606-32962628 AATTAGAGTCAGATTGTGGATGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1095269847 12:40204811-40204833 CCTCAGAGGTACCCTGTGGACGG + Intronic
1096553782 12:52390950-52390972 CCTCACTGGCACATTCTGGAGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098761722 12:74433801-74433823 CATGAGAGGGACATGATGGAAGG + Intergenic
1100256922 12:92893074-92893096 CATCAGAGACACATTTTGGAGGG + Intronic
1100650757 12:96585928-96585950 CATCAGAACCACACTTTGGATGG + Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102277448 12:111593770-111593792 CATTAGAGGTAAATTGTAGATGG - Intronic
1102282654 12:111630522-111630544 CTGCAGAGTCACATTGTGGGGGG + Intergenic
1104480876 12:129106931-129106953 CAATAGAGGCATGTTGTGGAAGG + Intronic
1104935113 12:132360295-132360317 CATCAGAGGCACGTGGGGTAGGG + Intergenic
1105771243 13:23614101-23614123 TATCAGAGGCACAGAGAGGAGGG - Intronic
1106405386 13:29468918-29468940 CTTCAGGGGCCCATTTTGGAAGG + Intronic
1106838335 13:33660051-33660073 CCTCAGAGGAACATTGAGGGAGG + Intergenic
1108449795 13:50549731-50549753 CCACAGAGCCACATTGTTGAGGG - Intronic
1111898818 13:94175316-94175338 AATCATTGACACATTGTGGATGG - Intronic
1112142964 13:96666269-96666291 CATCAGAGGGACCTGGTGGAAGG - Intronic
1112173826 13:97001241-97001263 CATCAGAGGCTCAATGCGGAGGG - Intergenic
1113391726 13:109904365-109904387 CAGTTGAGTCACATTGTGGAAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118601364 14:67473196-67473218 CAGCAGAGGGACATTGGGAAGGG - Exonic
1120552958 14:85893597-85893619 AATGACAGGCACTTTGTGGATGG - Intergenic
1121458147 14:94052359-94052381 CAGCAGAGGCAGTTTGTGCAGGG - Intronic
1122411888 14:101529751-101529773 CATGAGAAGCCCATGGTGGAGGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1130977519 15:88788870-88788892 CAGCAGAGGCACACTGTTGGTGG + Intergenic
1131115318 15:89791789-89791811 CATATGAGGCACATGGTGGGAGG + Intronic
1132256894 15:100383960-100383982 CATGAGAGCCACCTGGTGGAAGG + Intergenic
1133512300 16:6471868-6471890 CATCAGAAGCACATAGGGAAAGG + Intronic
1133658353 16:7889202-7889224 CATCAGAGTCACAATTTTGAGGG + Intergenic
1134020975 16:10921439-10921461 CATCACAGGAACATTGGTGAGGG - Intronic
1134569287 16:15277841-15277863 CATCGGAGGGACATGGTGGGAGG - Intergenic
1134733090 16:16478204-16478226 CATCGGAGGGACATGGTGGGAGG + Intergenic
1134934349 16:18233769-18233791 CATCGGAGGGACATGGTGGGAGG - Intergenic
1135497996 16:22969398-22969420 CAAGAGAGGCACATATTGGAGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139953130 16:70681454-70681476 GGGCAGAGGCACAGTGTGGAGGG + Intronic
1140058943 16:71550516-71550538 CATCAGAGGGACTATGTGCATGG + Intronic
1142272263 16:89096285-89096307 CACCAGGAGCACAGTGTGGAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144566241 17:16361950-16361972 CATCATTTGCACATTGTGGATGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1148442268 17:47717495-47717517 CAGCAAAAGCACACTGTGGATGG + Intergenic
1150924860 17:69522209-69522231 AATAATAGGCACACTGTGGAAGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1154314985 18:13297407-13297429 CAGCACAGGCACTTTCTGGAAGG + Intronic
1155035265 18:22020565-22020587 CAGCACAGGCACATGCTGGATGG - Intergenic
1155205119 18:23551937-23551959 CATCAATGGCACATGGTGCATGG + Intronic
1155258294 18:24017227-24017249 CATCAGAAGCACCTTTTGGGAGG - Intronic
1155960854 18:31993613-31993635 CATCAGGGTCACTTTCTGGAAGG - Intergenic
1156621532 18:38857377-38857399 CATGAGAGGGACATGATGGAGGG - Intergenic
1156732451 18:40210890-40210912 CATGAGATGCTCATTCTGGAGGG - Intergenic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157454040 18:47810355-47810377 GAGCAGAGGCACAGTGGGGATGG - Exonic
1157593113 18:48847998-48848020 CCGCAGAGGCACAGGGTGGATGG + Intronic
1159385690 18:67722795-67722817 CATGAGATGTACATTGGGGAAGG - Intergenic
1159895849 18:73995448-73995470 CATCAGAGGGACCTAGTGGGAGG + Intergenic
1160066034 18:75575161-75575183 CATCACAGCCACCTTTTGGAGGG + Intergenic
1160188638 18:76696365-76696387 CAGCAAAGGCACATTGCAGAGGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163236880 19:16035140-16035162 CATCACAGGCACCTCGGGGAAGG + Intergenic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925612567 2:5714432-5714454 CATCATACACACATTCTGGAAGG - Intergenic
927810985 2:26180039-26180061 CAACAGAGGAAAAATGTGGAGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928609788 2:32981688-32981710 CATGAGAGGGACCTGGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
930663697 2:54081341-54081363 TATTAGAGGTGCATTGTGGATGG - Intronic
931438632 2:62271010-62271032 CAAAAGAGGCACATTGTAGGTGG + Intergenic
931835816 2:66097524-66097546 CATGAGAGGGACCTTGTGGGGGG - Intergenic
933548023 2:83739881-83739903 CATTAGAGGGACCTTGTGGCAGG - Intergenic
934054245 2:88238740-88238762 CACCTGAGAGACATTGTGGATGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939883304 2:147654357-147654379 AATTAGAGGCACTTTGTGGTGGG - Intergenic
940161176 2:150715159-150715181 CATCAGAGGGACCTGGTAGAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940854737 2:158721168-158721190 CATCAGAAGCACTTGGGGGAGGG - Intergenic
942783279 2:179671603-179671625 CATCATAGGCACACAGTAGAAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943809833 2:192171242-192171264 CATCTGAGGGACTTTGTGTATGG - Intronic
944757646 2:202780606-202780628 AACCAGAGTCACAGTGTGGAGGG + Intronic
945061832 2:205916081-205916103 CATCAAAGACACACTGTGGTTGG - Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946332493 2:219018285-219018307 AAACAAAGGCACATGGTGGAGGG + Intronic
946698277 2:222383963-222383985 CATCAGAAGGACACTGTGGTAGG - Intergenic
1168994871 20:2125636-2125658 CAGCACAGGCACACTGTGGCAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169632134 20:7645946-7645968 CTTCAGAGGGACATTGTAGTAGG - Intergenic
1169830284 20:9817597-9817619 AATCAGAGTCACATTTTGGATGG + Intronic
1170602377 20:17850511-17850533 CAGCAAAGGCACATCGTGAAGGG + Intergenic
1172025689 20:31946696-31946718 CATCAGAGGCCAACTGAGGAAGG + Intronic
1172042346 20:32054242-32054264 TTTCAGAGGCACATCCTGGAAGG - Intronic
1172937019 20:38627745-38627767 CAACATAGGGACATAGTGGAAGG - Intronic
1175281985 20:57809953-57809975 CATGAAAGGCACAGTGGGGACGG - Intergenic
1176376165 21:6087789-6087811 CCTCAGGGCCACATTGGGGAGGG - Intergenic
1177500861 21:21952779-21952801 GATCAGTTGCACATTTTGGATGG - Intergenic
1179547016 21:42119271-42119293 CAGCAGAGGCACGGTCTGGAAGG - Exonic
1179598825 21:42461906-42461928 CATCAGAGGCAGGGTGAGGAGGG + Intergenic
1179747310 21:43450455-43450477 CCTCAGGGCCACATTGGGGAGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183016958 22:34996695-34996717 CAGCACAGGCACTATGTGGATGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184453359 22:44595848-44595870 CATCAGAGGGGCTTTGGGGATGG - Intergenic
1185286092 22:50000477-50000499 GACCAGAGGCACCTCGTGGAAGG - Exonic
953108033 3:39904720-39904742 GAGCAGAGGCACATCGTGGTTGG + Intronic
953397503 3:42584719-42584741 TATCAGAGACTCATTGTGGGAGG - Intronic
953586258 3:44203925-44203947 TATCAGAGGCAGGTTATGGAGGG - Intergenic
953823563 3:46230813-46230835 GATCAGAGGGCCAGTGTGGAGGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955145563 3:56315040-56315062 CATCAGTGGCATGTGGTGGAAGG - Intronic
959221635 3:103528673-103528695 AAGCAAAGGGACATTGTGGATGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959841110 3:110976430-110976452 GATCAGACTCACATTTTGGAAGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964635301 3:158851682-158851704 CATCAGAGGCCAGTTGAGGAGGG - Intergenic
964793168 3:160471635-160471657 CATGGGAGGGACATTGTGGGAGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967925532 3:194642984-194643006 CTTCACAGGCTCATTGTGTAAGG + Intronic
968180296 3:196590200-196590222 CATTAGAGGCATATTGTAGTGGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969497513 4:7534598-7534620 CATCACAGGGTCCTTGTGGAGGG + Intronic
969573885 4:8025395-8025417 CTTCGGAGCCACATTGTGGTGGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
977726449 4:100302228-100302250 CATCAGGGGCAGGTTGTGGTTGG + Intergenic
978310234 4:107379270-107379292 CATCAGAGGCAGGTGGTGTAGGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980427349 4:132643728-132643750 CTTCAGAGACACTTCGTGGAAGG - Intergenic
980525583 4:133988091-133988113 CATGGGAGGGACATTGTGGGAGG - Intergenic
981786376 4:148483788-148483810 CAGCAGAGCCACAAGGTGGAAGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982093509 4:151899760-151899782 CATCAGATGCACAGAGGGGATGG + Intergenic
982888637 4:160818645-160818667 CTTCTGGGCCACATTGTGGATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985889005 5:2701202-2701224 CCTCAAATGCACATTGTGAAAGG - Intergenic
986156355 5:5180151-5180173 CATCAGAGGCAAATTTAGAATGG + Intronic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
989142806 5:38218890-38218912 CACCAGAGGCACTTTGAGAAAGG + Intergenic
989202069 5:38773643-38773665 AGTCAGAGGCACAGTGTGGCTGG + Intergenic
989513656 5:42317507-42317529 CAGCAGTGGCTCATAGTGGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992256687 5:74928423-74928445 CAACAGTGGCACTTTGTGGCTGG + Intergenic
994686463 5:102959693-102959715 CATCAAAAGCACATTGTCAAAGG - Intronic
994814135 5:104562554-104562576 CATCTGAGGAAGTTTGTGGAAGG - Intergenic
995389613 5:111626066-111626088 CATCAGAGGGACCTGGTGGGAGG + Intergenic
995754871 5:115492252-115492274 CAGGAGAGGGTCATTGTGGAAGG - Intergenic
996347215 5:122500113-122500135 TATCATAGGAACATTGTGGGTGG + Intergenic
998845482 5:146304960-146304982 AAACAAAGGCAAATTGTGGATGG + Intronic
1001325925 5:170723989-170724011 CAGCAGAGTCAGATGGTGGAGGG + Intronic
1003380527 6:5620790-5620812 GATCAGAGGCAGTTGGTGGATGG + Intronic
1006190060 6:32202122-32202144 CTTCAGAGTCACACTGTGGGTGG + Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1013143377 6:107363229-107363251 CATCAGAGACAAACTGTTGAAGG + Intronic
1015593960 6:134848613-134848635 CAACAGAGGCACATTGTTGGAGG - Intergenic
1015749468 6:136545561-136545583 CATCGAAGTCAAATTGTGGAAGG - Intronic
1016118723 6:140321183-140321205 TCTCAGAGGGTCATTGTGGAGGG - Intergenic
1016549682 6:145264965-145264987 CATCAAAGGAACATTCAGGAAGG + Intergenic
1018644635 6:165936180-165936202 CATCAGAGGCTCAGTGTACAAGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020090249 7:5334765-5334787 CTTCACAGGCCCATTGTGTATGG + Intronic
1020447425 7:8283795-8283817 CATGGGAGGCACCTTGTGGGAGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022387836 7:29918144-29918166 CTTCAGAGTCACATTGAGCATGG + Intergenic
1023728879 7:43171033-43171055 CAACAGGGGCACACTGTGGTTGG + Intronic
1024347434 7:48327368-48327390 CATGAGAGGAACATGGTGGGAGG - Intronic
1025625095 7:63214074-63214096 CAGCAGAGGAACCTTCTGGAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026194336 7:68159762-68159784 CCTGAGAGGTACATTGTGGGAGG - Intergenic
1026623857 7:71975176-71975198 CAACAGAGGCACATTTAGGGAGG + Intronic
1029284685 7:99457605-99457627 CATCAGAGCCTCATTGGGGGTGG - Intronic
1029702377 7:102255690-102255712 AATCAGAAGCACAGTGTGTACGG + Exonic
1032701837 7:134388126-134388148 AATCAGAGGAAAATTTTGGAGGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035085137 7:156251918-156251940 CATCAGAGACACATTCGGCATGG + Intergenic
1035484465 7:159211898-159211920 CAGTAGAGACACATTGTGGCAGG - Intergenic
1037760211 8:21737042-21737064 CATCAGAGGAGTATTGGGGAAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039029442 8:33293782-33293804 CATAAGAGGGACATGGTGGGAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040319829 8:46286911-46286933 CCTCAGAGGGACATTGAGGCAGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1043623300 8:82225013-82225035 CATCAGAAGCACATTGATGGGGG - Intergenic
1043776493 8:84277234-84277256 AAGCAAAGGCACATTGTGGCAGG + Intronic
1044203907 8:89468983-89469005 CATCAGAGCCACACTGTGTAAGG + Intergenic
1044917549 8:97131616-97131638 CCCCAGAGGCATTTTGTGGAGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1056928052 9:90851407-90851429 AAACAGAGGCTCTTTGTGGAGGG + Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057955109 9:99401149-99401171 CTTCAGAGGAACTATGTGGAAGG - Intergenic
1058059597 9:100481139-100481161 TATGAGAGAGACATTGTGGATGG - Intronic
1061429961 9:130524568-130524590 CCACAGAGGGTCATTGTGGATGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188812203 X:34664481-34664503 CATCAGGAGAACATTGGGGAAGG - Intergenic
1189204447 X:39226014-39226036 TATCACAGACACATTGTGAAGGG - Intergenic
1189221401 X:39375337-39375359 CATTTGAGCCACATTGTGCAAGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1194706326 X:97179834-97179856 CATCACAGGCACTTTCTGCATGG + Intronic
1194756441 X:97744171-97744193 CATGGGAGGGACACTGTGGAAGG + Intergenic
1196183972 X:112725734-112725756 TATCAGAGGCTCTTTCTGGATGG - Intergenic
1198482038 X:137050399-137050421 GATAAAAGGCACAGTGTGGAGGG - Intergenic
1200357240 X:155564678-155564700 TATGAGTGGCACATTGTGGTGGG + Intronic
1201853972 Y:18520559-18520581 AATCAGTGCCACATTGTGAAAGG - Intergenic
1201879349 Y:18799825-18799847 AATCAGTGCCACATTGTGAAAGG + Intronic