ID: 1047885799

View in Genome Browser
Species Human (GRCh38)
Location 8:129248963-129248985
Sequence TAAGTGACTCAGTGGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047885799_1047885802 0 Left 1047885799 8:129248963-129248985 CCACCTCTCCACTGAGTCACTTA No data
Right 1047885802 8:129248986-129249008 GCTCCTTCAAGCAGTCCTCGTGG No data
1047885799_1047885803 1 Left 1047885799 8:129248963-129248985 CCACCTCTCCACTGAGTCACTTA No data
Right 1047885803 8:129248987-129249009 CTCCTTCAAGCAGTCCTCGTGGG No data
1047885799_1047885806 18 Left 1047885799 8:129248963-129248985 CCACCTCTCCACTGAGTCACTTA No data
Right 1047885806 8:129249004-129249026 CGTGGGTGATTGATATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047885799 Original CRISPR TAAGTGACTCAGTGGAGAGG TGG (reversed) Intergenic
No off target data available for this crispr