ID: 1047886473

View in Genome Browser
Species Human (GRCh38)
Location 8:129255488-129255510
Sequence TCACCTGGATGCTTTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047886471_1047886473 0 Left 1047886471 8:129255465-129255487 CCTGAGGGACAAAATTCACAGTT No data
Right 1047886473 8:129255488-129255510 TCACCTGGATGCTTTGATGAAGG No data
1047886466_1047886473 24 Left 1047886466 8:129255441-129255463 CCTGGATTTAGTCCTCCTGACTA No data
Right 1047886473 8:129255488-129255510 TCACCTGGATGCTTTGATGAAGG No data
1047886469_1047886473 12 Left 1047886469 8:129255453-129255475 CCTCCTGACTAACCTGAGGGACA No data
Right 1047886473 8:129255488-129255510 TCACCTGGATGCTTTGATGAAGG No data
1047886470_1047886473 9 Left 1047886470 8:129255456-129255478 CCTGACTAACCTGAGGGACAAAA No data
Right 1047886473 8:129255488-129255510 TCACCTGGATGCTTTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047886473 Original CRISPR TCACCTGGATGCTTTGATGA AGG Intergenic