ID: 1047886707

View in Genome Browser
Species Human (GRCh38)
Location 8:129259166-129259188
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047886702_1047886707 12 Left 1047886702 8:129259131-129259153 CCTTTCACACATTATGCAAATTA No data
Right 1047886707 8:129259166-129259188 CAATATACACAATGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047886707 Original CRISPR CAATATACACAATGGGAGGA GGG Intergenic
No off target data available for this crispr