ID: 1047890252

View in Genome Browser
Species Human (GRCh38)
Location 8:129301084-129301106
Sequence TCACATAAACTTAAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047890252_1047890257 26 Left 1047890252 8:129301084-129301106 CCCTCTACCTTAAGTTTATGTGA No data
Right 1047890257 8:129301133-129301155 GAAGACAGAAGAAACTTGGTTGG No data
1047890252_1047890256 22 Left 1047890252 8:129301084-129301106 CCCTCTACCTTAAGTTTATGTGA No data
Right 1047890256 8:129301129-129301151 TCTTGAAGACAGAAGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047890252 Original CRISPR TCACATAAACTTAAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr