ID: 1047890256

View in Genome Browser
Species Human (GRCh38)
Location 8:129301129-129301151
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047890253_1047890256 21 Left 1047890253 8:129301085-129301107 CCTCTACCTTAAGTTTATGTGAA No data
Right 1047890256 8:129301129-129301151 TCTTGAAGACAGAAGAAACTTGG No data
1047890252_1047890256 22 Left 1047890252 8:129301084-129301106 CCCTCTACCTTAAGTTTATGTGA No data
Right 1047890256 8:129301129-129301151 TCTTGAAGACAGAAGAAACTTGG No data
1047890250_1047890256 26 Left 1047890250 8:129301080-129301102 CCACCCCTCTACCTTAAGTTTAT 0: 7
1: 194
2: 457
3: 400
4: 421
Right 1047890256 8:129301129-129301151 TCTTGAAGACAGAAGAAACTTGG No data
1047890251_1047890256 23 Left 1047890251 8:129301083-129301105 CCCCTCTACCTTAAGTTTATGTG No data
Right 1047890256 8:129301129-129301151 TCTTGAAGACAGAAGAAACTTGG No data
1047890254_1047890256 15 Left 1047890254 8:129301091-129301113 CCTTAAGTTTATGTGAATCCTCA No data
Right 1047890256 8:129301129-129301151 TCTTGAAGACAGAAGAAACTTGG No data
1047890255_1047890256 -3 Left 1047890255 8:129301109-129301131 CCTCATGTGTTAGATGAGTCTCT No data
Right 1047890256 8:129301129-129301151 TCTTGAAGACAGAAGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047890256 Original CRISPR TCTTGAAGACAGAAGAAACT TGG Intergenic
No off target data available for this crispr