ID: 1047890865

View in Genome Browser
Species Human (GRCh38)
Location 8:129307204-129307226
Sequence AATCACTTTGAGCAGTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047890864_1047890865 11 Left 1047890864 8:129307170-129307192 CCAGACACTTTAAATGGCTGGTT No data
Right 1047890865 8:129307204-129307226 AATCACTTTGAGCAGTTAAATGG No data
1047890861_1047890865 25 Left 1047890861 8:129307156-129307178 CCTTAAGAAAATATCCAGACACT No data
Right 1047890865 8:129307204-129307226 AATCACTTTGAGCAGTTAAATGG No data
1047890860_1047890865 26 Left 1047890860 8:129307155-129307177 CCCTTAAGAAAATATCCAGACAC No data
Right 1047890865 8:129307204-129307226 AATCACTTTGAGCAGTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047890865 Original CRISPR AATCACTTTGAGCAGTTAAA TGG Intergenic
No off target data available for this crispr