ID: 1047898663

View in Genome Browser
Species Human (GRCh38)
Location 8:129396237-129396259
Sequence TGTAGGATCACGAAGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047898663_1047898667 18 Left 1047898663 8:129396237-129396259 CCCTGGGACTTCGTGATCCTACA No data
Right 1047898667 8:129396278-129396300 TAATTTTACGCTTCAGATTAGGG No data
1047898663_1047898666 17 Left 1047898663 8:129396237-129396259 CCCTGGGACTTCGTGATCCTACA No data
Right 1047898666 8:129396277-129396299 ATAATTTTACGCTTCAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047898663 Original CRISPR TGTAGGATCACGAAGTCCCA GGG (reversed) Intergenic
No off target data available for this crispr