ID: 1047898666

View in Genome Browser
Species Human (GRCh38)
Location 8:129396277-129396299
Sequence ATAATTTTACGCTTCAGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047898663_1047898666 17 Left 1047898663 8:129396237-129396259 CCCTGGGACTTCGTGATCCTACA No data
Right 1047898666 8:129396277-129396299 ATAATTTTACGCTTCAGATTAGG No data
1047898665_1047898666 0 Left 1047898665 8:129396254-129396276 CCTACAAATTATATTTAAACATC No data
Right 1047898666 8:129396277-129396299 ATAATTTTACGCTTCAGATTAGG No data
1047898664_1047898666 16 Left 1047898664 8:129396238-129396260 CCTGGGACTTCGTGATCCTACAA No data
Right 1047898666 8:129396277-129396299 ATAATTTTACGCTTCAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047898666 Original CRISPR ATAATTTTACGCTTCAGATT AGG Intergenic
No off target data available for this crispr