ID: 1047899617

View in Genome Browser
Species Human (GRCh38)
Location 8:129405906-129405928
Sequence GACTCACAGTACCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047899612_1047899617 22 Left 1047899612 8:129405861-129405883 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1047899617 8:129405906-129405928 GACTCACAGTACCACGTGGCTGG No data
1047899613_1047899617 21 Left 1047899613 8:129405862-129405884 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1047899617 8:129405906-129405928 GACTCACAGTACCACGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047899617 Original CRISPR GACTCACAGTACCACGTGGC TGG Intergenic
No off target data available for this crispr