ID: 1047899919

View in Genome Browser
Species Human (GRCh38)
Location 8:129409137-129409159
Sequence ACCCAGGGTGAAGAGTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047899916_1047899919 -7 Left 1047899916 8:129409121-129409143 CCACACATCAGGTACTACCCAGG No data
Right 1047899919 8:129409137-129409159 ACCCAGGGTGAAGAGTCATAAGG No data
1047899914_1047899919 21 Left 1047899914 8:129409093-129409115 CCTTCAATAAATATTTTTTGAGC No data
Right 1047899919 8:129409137-129409159 ACCCAGGGTGAAGAGTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047899919 Original CRISPR ACCCAGGGTGAAGAGTCATA AGG Intergenic