ID: 1047900552

View in Genome Browser
Species Human (GRCh38)
Location 8:129417032-129417054
Sequence GTACCTTAGTGAATTCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047900549_1047900552 15 Left 1047900549 8:129416994-129417016 CCGTCTGTCCTATATAACATCTC No data
Right 1047900552 8:129417032-129417054 GTACCTTAGTGAATTCATCAGGG No data
1047900550_1047900552 7 Left 1047900550 8:129417002-129417024 CCTATATAACATCTCACAGTGTC No data
Right 1047900552 8:129417032-129417054 GTACCTTAGTGAATTCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047900552 Original CRISPR GTACCTTAGTGAATTCATCA GGG Intergenic
No off target data available for this crispr