ID: 1047900554

View in Genome Browser
Species Human (GRCh38)
Location 8:129417044-129417066
Sequence ATTCATCAGGGCTCACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047900549_1047900554 27 Left 1047900549 8:129416994-129417016 CCGTCTGTCCTATATAACATCTC No data
Right 1047900554 8:129417044-129417066 ATTCATCAGGGCTCACAATCTGG No data
1047900550_1047900554 19 Left 1047900550 8:129417002-129417024 CCTATATAACATCTCACAGTGTC No data
Right 1047900554 8:129417044-129417066 ATTCATCAGGGCTCACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047900554 Original CRISPR ATTCATCAGGGCTCACAATC TGG Intergenic
No off target data available for this crispr