ID: 1047903987

View in Genome Browser
Species Human (GRCh38)
Location 8:129453417-129453439
Sequence TTGGCTAAAAGGCTGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047903987_1047903993 5 Left 1047903987 8:129453417-129453439 CCTCCCACCAGCCTTTTAGCCAA No data
Right 1047903993 8:129453445-129453467 GAGCTCCTTTCCTATCCTCCTGG No data
1047903987_1047903999 21 Left 1047903987 8:129453417-129453439 CCTCCCACCAGCCTTTTAGCCAA No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data
1047903987_1047903994 6 Left 1047903987 8:129453417-129453439 CCTCCCACCAGCCTTTTAGCCAA No data
Right 1047903994 8:129453446-129453468 AGCTCCTTTCCTATCCTCCTGGG No data
1047903987_1047903996 10 Left 1047903987 8:129453417-129453439 CCTCCCACCAGCCTTTTAGCCAA No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047903987 Original CRISPR TTGGCTAAAAGGCTGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr