ID: 1047903996

View in Genome Browser
Species Human (GRCh38)
Location 8:129453450-129453472
Sequence CCTTTCCTATCCTCCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047903984_1047903996 23 Left 1047903984 8:129453404-129453426 CCACCGCGCCTGGCCTCCCACCA No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903989_1047903996 6 Left 1047903989 8:129453421-129453443 CCACCAGCCTTTTAGCCAAGAGA No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903987_1047903996 10 Left 1047903987 8:129453417-129453439 CCTCCCACCAGCCTTTTAGCCAA No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903988_1047903996 7 Left 1047903988 8:129453420-129453442 CCCACCAGCCTTTTAGCCAAGAG No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903990_1047903996 3 Left 1047903990 8:129453424-129453446 CCAGCCTTTTAGCCAAGAGATGA No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903985_1047903996 20 Left 1047903985 8:129453407-129453429 CCGCGCCTGGCCTCCCACCAGCC No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903992_1047903996 -9 Left 1047903992 8:129453436-129453458 CCAAGAGATGAGCTCCTTTCCTA No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903986_1047903996 15 Left 1047903986 8:129453412-129453434 CCTGGCCTCCCACCAGCCTTTTA No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data
1047903991_1047903996 -1 Left 1047903991 8:129453428-129453450 CCTTTTAGCCAAGAGATGAGCTC No data
Right 1047903996 8:129453450-129453472 CCTTTCCTATCCTCCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047903996 Original CRISPR CCTTTCCTATCCTCCTGGGA AGG Intergenic
No off target data available for this crispr