ID: 1047903999

View in Genome Browser
Species Human (GRCh38)
Location 8:129453461-129453483
Sequence CTCCTGGGAAGGACATGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047903988_1047903999 18 Left 1047903988 8:129453420-129453442 CCCACCAGCCTTTTAGCCAAGAG No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data
1047903991_1047903999 10 Left 1047903991 8:129453428-129453450 CCTTTTAGCCAAGAGATGAGCTC No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data
1047903990_1047903999 14 Left 1047903990 8:129453424-129453446 CCAGCCTTTTAGCCAAGAGATGA No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data
1047903986_1047903999 26 Left 1047903986 8:129453412-129453434 CCTGGCCTCCCACCAGCCTTTTA No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data
1047903987_1047903999 21 Left 1047903987 8:129453417-129453439 CCTCCCACCAGCCTTTTAGCCAA No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data
1047903989_1047903999 17 Left 1047903989 8:129453421-129453443 CCACCAGCCTTTTAGCCAAGAGA No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data
1047903992_1047903999 2 Left 1047903992 8:129453436-129453458 CCAAGAGATGAGCTCCTTTCCTA No data
Right 1047903999 8:129453461-129453483 CTCCTGGGAAGGACATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047903999 Original CRISPR CTCCTGGGAAGGACATGAGA AGG Intergenic
No off target data available for this crispr