ID: 1047916729

View in Genome Browser
Species Human (GRCh38)
Location 8:129591853-129591875
Sequence CAGGGTCCTGACCCCCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047916721_1047916729 30 Left 1047916721 8:129591800-129591822 CCTCTTAAGAGATTAAGTGCAAG No data
Right 1047916729 8:129591853-129591875 CAGGGTCCTGACCCCCTTCCAGG No data
1047916725_1047916729 2 Left 1047916725 8:129591828-129591850 CCAAGCTGAAATGGAGGCATCAG No data
Right 1047916729 8:129591853-129591875 CAGGGTCCTGACCCCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047916729 Original CRISPR CAGGGTCCTGACCCCCTTCC AGG Intergenic
No off target data available for this crispr