ID: 1047920500

View in Genome Browser
Species Human (GRCh38)
Location 8:129629913-129629935
Sequence CTGTGAGGGCTTTTGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047920500_1047920507 4 Left 1047920500 8:129629913-129629935 CCTTATTCCAAAAGCCCTCACAG No data
Right 1047920507 8:129629940-129629962 CTCATATGCACAATTTTTGGTGG No data
1047920500_1047920504 1 Left 1047920500 8:129629913-129629935 CCTTATTCCAAAAGCCCTCACAG No data
Right 1047920504 8:129629937-129629959 TCCCTCATATGCACAATTTTTGG No data
1047920500_1047920508 18 Left 1047920500 8:129629913-129629935 CCTTATTCCAAAAGCCCTCACAG No data
Right 1047920508 8:129629954-129629976 TTTTGGTGGTGACAGCAGAGTGG No data
1047920500_1047920509 25 Left 1047920500 8:129629913-129629935 CCTTATTCCAAAAGCCCTCACAG No data
Right 1047920509 8:129629961-129629983 GGTGACAGCAGAGTGGCAAAAGG No data
1047920500_1047920510 28 Left 1047920500 8:129629913-129629935 CCTTATTCCAAAAGCCCTCACAG No data
Right 1047920510 8:129629964-129629986 GACAGCAGAGTGGCAAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047920500 Original CRISPR CTGTGAGGGCTTTTGGAATA AGG (reversed) Intergenic
No off target data available for this crispr