ID: 1047921522

View in Genome Browser
Species Human (GRCh38)
Location 8:129639564-129639586
Sequence TGGTGCTCTCTCCTTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047921522_1047921525 9 Left 1047921522 8:129639564-129639586 CCTTGAAGAAGGAGAGAGCACCA No data
Right 1047921525 8:129639596-129639618 CTACATAATCAGATGGCTCATGG No data
1047921522_1047921524 2 Left 1047921522 8:129639564-129639586 CCTTGAAGAAGGAGAGAGCACCA No data
Right 1047921524 8:129639589-129639611 TATTCTTCTACATAATCAGATGG No data
1047921522_1047921527 26 Left 1047921522 8:129639564-129639586 CCTTGAAGAAGGAGAGAGCACCA No data
Right 1047921527 8:129639613-129639635 TCATGGACCTAAAGCACACAGGG No data
1047921522_1047921526 25 Left 1047921522 8:129639564-129639586 CCTTGAAGAAGGAGAGAGCACCA No data
Right 1047921526 8:129639612-129639634 CTCATGGACCTAAAGCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047921522 Original CRISPR TGGTGCTCTCTCCTTCTTCA AGG (reversed) Intergenic
No off target data available for this crispr