ID: 1047921525

View in Genome Browser
Species Human (GRCh38)
Location 8:129639596-129639618
Sequence CTACATAATCAGATGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047921521_1047921525 10 Left 1047921521 8:129639563-129639585 CCCTTGAAGAAGGAGAGAGCACC No data
Right 1047921525 8:129639596-129639618 CTACATAATCAGATGGCTCATGG No data
1047921522_1047921525 9 Left 1047921522 8:129639564-129639586 CCTTGAAGAAGGAGAGAGCACCA No data
Right 1047921525 8:129639596-129639618 CTACATAATCAGATGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047921525 Original CRISPR CTACATAATCAGATGGCTCA TGG Intergenic
No off target data available for this crispr