ID: 1047925992

View in Genome Browser
Species Human (GRCh38)
Location 8:129683125-129683147
Sequence TAATTAGTAGGTAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047925987_1047925992 20 Left 1047925987 8:129683082-129683104 CCAACATTTAGGTAGGCTTGGGA No data
Right 1047925992 8:129683125-129683147 TAATTAGTAGGTAAAATGGCAGG No data
1047925983_1047925992 30 Left 1047925983 8:129683072-129683094 CCAGGTGATTCCAACATTTAGGT No data
Right 1047925992 8:129683125-129683147 TAATTAGTAGGTAAAATGGCAGG No data
1047925988_1047925992 -4 Left 1047925988 8:129683106-129683128 CCACTGACTTACGTTCTCCTAAT No data
Right 1047925992 8:129683125-129683147 TAATTAGTAGGTAAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047925992 Original CRISPR TAATTAGTAGGTAAAATGGC AGG Intergenic
No off target data available for this crispr