ID: 1047926104

View in Genome Browser
Species Human (GRCh38)
Location 8:129684077-129684099
Sequence CAGGCACAAATGATGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047926104_1047926105 -7 Left 1047926104 8:129684077-129684099 CCTGAAAACATCATTTGTGCCTG No data
Right 1047926105 8:129684093-129684115 GTGCCTGTTTTTAAATTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047926104 Original CRISPR CAGGCACAAATGATGTTTTC AGG (reversed) Intergenic
No off target data available for this crispr