ID: 1047927202

View in Genome Browser
Species Human (GRCh38)
Location 8:129693398-129693420
Sequence TGTCCTCCACCCTGGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047927202_1047927206 10 Left 1047927202 8:129693398-129693420 CCTCTGGGCCAGGGTGGAGGACA No data
Right 1047927206 8:129693431-129693453 AACAGAAGCCTCTTTGTTATTGG No data
1047927202_1047927208 26 Left 1047927202 8:129693398-129693420 CCTCTGGGCCAGGGTGGAGGACA No data
Right 1047927208 8:129693447-129693469 TTATTGGCAGCTCCTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047927202 Original CRISPR TGTCCTCCACCCTGGCCCAG AGG (reversed) Intergenic