ID: 1047937014

View in Genome Browser
Species Human (GRCh38)
Location 8:129791872-129791894
Sequence TGTCCAATACTAAAAGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047937011_1047937014 13 Left 1047937011 8:129791836-129791858 CCAATGTTTCTTTCTTGGGTTTC No data
Right 1047937014 8:129791872-129791894 TGTCCAATACTAAAAGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047937014 Original CRISPR TGTCCAATACTAAAAGTCGT GGG Intergenic
No off target data available for this crispr