ID: 1047937599

View in Genome Browser
Species Human (GRCh38)
Location 8:129797734-129797756
Sequence CAGTGGGAAGAGAGAGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047937590_1047937599 9 Left 1047937590 8:129797702-129797724 CCCTTGTGAGATAAAGTCTTACA No data
Right 1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG No data
1047937585_1047937599 22 Left 1047937585 8:129797689-129797711 CCCTCCCCAAGGACCCTTGTGAG 0: 3
1: 46
2: 130
3: 163
4: 375
Right 1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG No data
1047937589_1047937599 16 Left 1047937589 8:129797695-129797717 CCAAGGACCCTTGTGAGATAAAG No data
Right 1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG No data
1047937588_1047937599 17 Left 1047937588 8:129797694-129797716 CCCAAGGACCCTTGTGAGATAAA No data
Right 1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG No data
1047937591_1047937599 8 Left 1047937591 8:129797703-129797725 CCTTGTGAGATAAAGTCTTACAT No data
Right 1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG No data
1047937587_1047937599 18 Left 1047937587 8:129797693-129797715 CCCCAAGGACCCTTGTGAGATAA No data
Right 1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG No data
1047937586_1047937599 21 Left 1047937586 8:129797690-129797712 CCTCCCCAAGGACCCTTGTGAGA 0: 3
1: 35
2: 83
3: 121
4: 223
Right 1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047937599 Original CRISPR CAGTGGGAAGAGAGAGAAGG GGG Intergenic
No off target data available for this crispr