ID: 1047940296

View in Genome Browser
Species Human (GRCh38)
Location 8:129822672-129822694
Sequence CTGGTCTGACAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047940288_1047940296 6 Left 1047940288 8:129822643-129822665 CCAGGCCACACTGAGGAAAGCTG No data
Right 1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG No data
1047940286_1047940296 20 Left 1047940286 8:129822629-129822651 CCAGGGGTGGGGAGCCAGGCCAC No data
Right 1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG No data
1047940289_1047940296 1 Left 1047940289 8:129822648-129822670 CCACACTGAGGAAAGCTGCCACA No data
Right 1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047940296 Original CRISPR CTGGTCTGACAGAGGGAGCT GGG Intergenic
No off target data available for this crispr