ID: 1047944125

View in Genome Browser
Species Human (GRCh38)
Location 8:129858020-129858042
Sequence CTTTCAACATAGATCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047944125 Original CRISPR CTTTCAACATAGATCTACCA TGG (reversed) Intronic
901623864 1:10612248-10612270 CTTTCCCCATAGAGCTACCTTGG + Intronic
904814437 1:33184560-33184582 GTTGGAACATAGATGTACCAGGG + Intergenic
906236757 1:44216137-44216159 CATTCAACAAATATTTACCATGG - Intronic
915833031 1:159148622-159148644 ATTTAAAAATAGAGCTACCATGG + Intergenic
918586983 1:186199607-186199629 ATTTAAACATAGATTTACCAAGG - Intergenic
920086829 1:203423523-203423545 CTTTCCCCCAAGATCTACCAGGG - Intergenic
924094294 1:240535472-240535494 CTTTAAACATTGGTTTACCAAGG - Intronic
1064247767 10:13682943-13682965 CTTTCTACACAGGTTTACCAGGG - Intronic
1064855179 10:19759650-19759672 CATTCAATAAAAATCTACCAGGG - Intronic
1067041700 10:42956638-42956660 CTTTCAACAGGGATCTAGCAGGG - Intergenic
1068124266 10:52818706-52818728 TTTTCAATATAGATATTCCAGGG - Intergenic
1068742019 10:60484150-60484172 CATTCAACAGAGATCTAAGATGG + Intronic
1070303065 10:75219292-75219314 CTTTCAAAATAGATTTGTCAAGG + Exonic
1071479757 10:86056339-86056361 GTTGCAACAAAGATCTCCCAAGG + Intronic
1079786163 11:24675511-24675533 CTTTCAAAATAGAACTGTCATGG + Intronic
1085560425 11:77467590-77467612 CTTTCAAAATAGAGATGCCAAGG + Intronic
1086047780 11:82553217-82553239 GTTTCAACAAAGAGCTAACAAGG + Intergenic
1088158414 11:106838295-106838317 CTTTAAAAATAGGTCTAGCATGG + Intronic
1088475336 11:110232215-110232237 CTTTCCACATTTATCAACCATGG + Intronic
1093877340 12:24364945-24364967 CTTTCAAAATAGTTATACAAAGG - Intergenic
1095317203 12:40779374-40779396 CTTTTAAAATAATTCTACCAAGG + Intronic
1095555225 12:43494764-43494786 GTTTTAAAATACATCTACCATGG + Intronic
1097273782 12:57796836-57796858 CCTTCAACATAGATTTATTATGG + Intronic
1101456648 12:104839044-104839066 CTTTCAAAATAAATTTCCCATGG + Intronic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1112386495 13:98945116-98945138 CTTATAACATACATCTTCCAGGG + Intronic
1112403369 13:99095848-99095870 CTTTCCACAAAGACCTAACATGG + Intergenic
1112668982 13:101613319-101613341 CAGTCAACATATATTTACCAGGG + Intronic
1115782036 14:36779833-36779855 TATTCAAAATAGAACTACCATGG - Intronic
1125209939 15:37202710-37202732 CTTCCAACCAAGAGCTACCATGG - Intergenic
1127658002 15:61073763-61073785 CTTTTAAAGTAGATCTAACATGG - Intronic
1127771605 15:62235813-62235835 CTTTCAACATAAACCCATCAAGG - Intergenic
1128687547 15:69698074-69698096 CATTCAAAAGAGCTCTACCAGGG - Intergenic
1131635424 15:94228613-94228635 ATGTCAATTTAGATCTACCAGGG - Intergenic
1135223376 16:20634297-20634319 AGTTCAACATAGAATTACCATGG + Intronic
1139127467 16:64096581-64096603 CTTTCAACACAAATCTAATAAGG + Intergenic
1139271325 16:65686125-65686147 CTCTCTAAATAGATCTACCATGG - Intergenic
1139925782 16:70485514-70485536 CTTTTAACATAGATAAATCATGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149891840 17:60396747-60396769 CCTTTAACTTAGATCTACCTTGG + Intronic
1150047705 17:61929390-61929412 CTTTCAACATAGATCAGCAAAGG + Intergenic
1150463738 17:65374095-65374117 CTTTAAACATAGACTTACCAGGG + Intergenic
1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG + Intergenic
1150940569 17:69688790-69688812 CATTCCACAAAGATCTTCCAAGG + Intergenic
1156991141 18:43409070-43409092 CTTTCCAAATAGTTTTACCAAGG - Intergenic
1159538081 18:69740413-69740435 TTTTCAACCAAGATTTACCATGG + Intronic
1162715915 19:12633368-12633390 ATTTCAACATGGATCTATAAAGG - Intronic
925354615 2:3229776-3229798 CTTTCAGCACAGATCTTCAACGG + Intronic
931198101 2:60072349-60072371 CTTTCAACAAACATCCATCAAGG - Intergenic
932432457 2:71684148-71684170 CCTGCAACCTAGATCTACCCTGG - Intronic
933124124 2:78582808-78582830 CTTTCATCATAATTCCACCAAGG - Intergenic
933588814 2:84208965-84208987 CTTTCAACAGTGATTTGCCAGGG + Intergenic
942254250 2:174077699-174077721 ATTACAACATAGATCTACTAAGG + Intronic
942559418 2:177204559-177204581 CTTAAGACATAGATCTCCCAGGG + Intergenic
942677028 2:178438045-178438067 TTTTCAACATAGAACTATAAAGG - Intronic
943857039 2:192809094-192809116 CTTTCAACAACGTTCTTCCAGGG + Intergenic
945412400 2:209526878-209526900 ATTCCATCATAGATCTGCCATGG - Intronic
1175125181 20:56746130-56746152 CTTTCAATATATATCTCCTAGGG - Intergenic
1175152515 20:56946344-56946366 CTTTCATCTTAGATCTGCCTTGG + Intergenic
1182121899 22:27793136-27793158 GTTTCAAGATAGAGCTACCAGGG + Intronic
1183484875 22:38083397-38083419 CTTTCAACAGATATCAGCCAGGG + Intronic
951057106 3:18160265-18160287 CTTTCAAGGAAGATATACCAAGG + Intronic
954251111 3:49368240-49368262 CTTTCAGCCTAGGTCTCCCATGG - Intronic
958269763 3:91485323-91485345 CTTTCTAGTTAGTTCTACCAAGG - Intergenic
959351515 3:105270915-105270937 CTTTTAACATAGATCAACCTGGG + Intergenic
959581552 3:107988093-107988115 CATTCAACATATAATTACCAAGG - Intergenic
960399573 3:117179951-117179973 CTTTCAAGATAGATCAAACAGGG - Intergenic
964193101 3:154029149-154029171 CTTTAAATAGAGATCTACTAAGG + Intergenic
965096085 3:164227876-164227898 CTTTCATCTTACATCTATCAAGG + Intergenic
965224353 3:165969685-165969707 CTTTTAACATAGAATTACCTTGG + Intergenic
965550200 3:169956654-169956676 CTTTGTACATCCATCTACCATGG - Intergenic
967509157 3:190289555-190289577 TTTTCAACATAGAACCTCCATGG - Intergenic
970532042 4:16994764-16994786 CTTTCAACAAACATCTAGCAAGG - Intergenic
973872702 4:55182261-55182283 GATTCAAGATAGATCTATCATGG + Intergenic
975122770 4:70747038-70747060 CTTTTAACCTAGTTCTCCCAAGG - Intronic
976961096 4:90975057-90975079 TTTACAATATAGATCTACCTTGG + Intronic
977881644 4:102211459-102211481 CTTTCCACTTAGTTCTCCCATGG + Intergenic
978050030 4:104187151-104187173 CTTTAAACATACTTTTACCATGG + Intergenic
978241534 4:106522745-106522767 CTTTCAAAAAAGAGCTAACATGG - Intergenic
978530786 4:109710937-109710959 CTTTTGACATAGTTCTTCCAGGG - Exonic
979425151 4:120554703-120554725 CTTTCAATATATATATAACACGG - Intergenic
979713377 4:123807483-123807505 CTTTCAAAATTGATGTTCCATGG - Intergenic
980110223 4:128629051-128629073 CATCCAACATTGATCTCCCACGG - Intergenic
980899620 4:138892313-138892335 CTTTCAAAATGCATATACCAGGG - Intergenic
983279871 4:165666981-165667003 CTTTCAACAAATAACTAACAAGG - Intergenic
985963091 5:3318288-3318310 CTTTCAAAATAAATCAAACATGG + Intergenic
986382948 5:7205060-7205082 CTTACAACAGTGATCTGCCAGGG - Intergenic
988299976 5:29410648-29410670 CTTTTAAGAAATATCTACCAAGG - Intergenic
991217363 5:64171002-64171024 ATTTCAACATAGGTCTATTAGGG + Intronic
991543202 5:67752297-67752319 CTGTCACCATAGTTCTCCCATGG - Intergenic
991631168 5:68657529-68657551 CTTTCAGCTTAGGTCTATCAGGG + Intergenic
997437553 5:133885986-133886008 CTCTCAACCAAGACCTACCAAGG + Intergenic
998707714 5:144782896-144782918 CTTCCACAATAGATTTACCAAGG - Intergenic
999045641 5:148466257-148466279 CCTTCAACATAGACATATCATGG - Intronic
1000712967 5:164603702-164603724 CTTTCAAAATATATCTGTCATGG + Intergenic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003317564 6:5026098-5026120 CTTTCAACAGAGGTTTTCCACGG - Intergenic
1004272023 6:14204130-14204152 TTCTCAACACAGATCTTCCAAGG + Intergenic
1004907998 6:20255151-20255173 CTCTCAAAATTGGTCTACCAGGG - Intergenic
1005723986 6:28630982-28631004 CTTTTAAAATATATGTACCATGG - Intergenic
1009173429 6:60428997-60429019 CTTTCTAGTTAGTTCTACCAAGG + Intergenic
1009718680 6:67435041-67435063 ATTTCAACATAGATTTTCCAGGG - Intergenic
1009933528 6:70205016-70205038 ATTTCAATATAGATCAACTATGG + Intronic
1010106823 6:72180084-72180106 CTTTCAACAAAGGTCTCCTAAGG - Intronic
1018500839 6:164409772-164409794 CTTTCATCATAGCTTTTCCATGG + Intergenic
1019277989 7:186011-186033 CTTTAAAAATAGTTCTACCTGGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025545524 7:62161349-62161371 TTTTCAACATAGATCTCAAAGGG + Intergenic
1027969196 7:85056774-85056796 CTTTCAACTAATATATACCACGG - Intronic
1028464369 7:91133829-91133851 TCTTCAACATAGATCTACAGAGG - Intronic
1030552820 7:110986088-110986110 CTTTCAACATAGATGTGCGTTGG + Intronic
1038369222 8:26970795-26970817 CTTTCACCATAGAATTATCATGG + Intergenic
1042279427 8:67040116-67040138 CTTACAACAGAGAATTACCAGGG - Intronic
1047783434 8:128130372-128130394 CTTTAAAGATAGAACTACAAAGG - Intergenic
1047944125 8:129858020-129858042 CTTTCAACATAGATCTACCATGG - Intronic
1048376091 8:133823489-133823511 ATTTCAACTTGAATCTACCAAGG + Intergenic
1050818465 9:9846538-9846560 CTTTCAACATATAGCAATCATGG + Intronic
1051236853 9:15009850-15009872 ATCTGAACATACATCTACCATGG + Intergenic
1052977011 9:34418757-34418779 CTTTAAAAATAGATCTACAATGG + Intronic
1053005644 9:34602577-34602599 CTACCAACATAGAGCTACCTAGG + Intergenic
1054259111 9:62844696-62844718 CGTTTAATATAGATTTACCAGGG + Intergenic
1059784237 9:117563341-117563363 TTTTCCACAAAGATCTCCCAGGG + Intergenic
1186026963 X:5323872-5323894 CTTTCATCAGAGACCTACCTGGG + Intergenic
1186968914 X:14818556-14818578 CCTTCAACTTAGATTTTCCAGGG - Intergenic
1195961356 X:110390239-110390261 ATTTCATCATGGATCTACAAGGG - Intronic
1198534416 X:137573244-137573266 CTTTGAACAAAGATCTTACAAGG - Intronic